Top » Catalog » SNPs » A1160

$18.00

A1160
[A1160]

A1160
HG19 Position: ChrY:14412003..14412003
Ancestral: T
Derived: C
Reference: David R Moore (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1c (not loisted)
Comments: Below L1402
Forward Primer: A1160_F CATGCTCAACAGAGATGTTATGG
Reverse Primer: A1160_R TCTCACTATGTTGCCCAGGTC
Reviews

Customers who bought this product also purchased
L1402
L1402
A459
A459
A1159
A1159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies