Top » Catalog » SNPs » A1163

$17.50

A1163
[A1163]

A1163
HG19 Position: ChrY:14173243..14173243
Ancestral: G
Derived: C
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255, approx. Z16950
Forward Primer: A1163_F ATTTCTCATGCTTCTGGAGAGC
Reverse Primer: A1163_R AATGGACATAGCACCATCCG
Reviews

Customers who bought this product also purchased
BY2573
BY2573
A5411
A5411
Z255
Z255
Z16950
Z16950
Z16437
Z16437
Z16431
Z16431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies