Top » Catalog » SNPs » A1163

$17.50

A1163
[A1163]

A1163
HG19 Position: ChrY:14173243..14173243
Ancestral: G
Derived: C
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255, approx. Z16950
Forward Primer: A1163_F ATTTCTCATGCTTCTGGAGAGC
Reverse Primer: A1163_R AATGGACATAGCACCATCCG
Reviews

Customers who bought this product also purchased
A5411
A5411
BY2573
BY2573
A1236
A1236
R1b-Z255 Panel
R1b-Z255 Panel
L159.2
L159.2
S23035
S23035
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies