Top » Catalog » SNPs » A1164

$18.00

A1164
[A1164]

A1164
HG19 Position: ChrY:14201511..14201511
Ancestral: C
Derived: T
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255, approx. Z16950
Forward Primer: A1164_F GAGTAACATCTTGGGCTCCAAC
Reverse Primer: A1164_R ATTACAGGTGTGAGCCACTGC
Reviews

Customers who bought this product also purchased
A1165
A1165
A1163
A1163
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies