Top » Catalog » SNPs » A1164

$18.00

A1164
[A1164]

A1164
HG19 Position: ChrY:14201511..14201511
Ancestral: C
Derived: T
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255, approx. Z16950
Forward Primer: A1164_F GAGTAACATCTTGGGCTCCAAC
Reverse Primer: A1164_R ATTACAGGTGTGAGCCACTGC
Reviews

Customers who bought this product also purchased
A1165
A1165
A1163
A1163
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies