Top » Catalog » SNPs » A1164

$18.00

A1164
[A1164]

A1164
HG19 Position: ChrY:12080805..12080805
Ancestral: C
Derived: T
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255. approx. Z16950
Forward Primer: A1164_F GAGTAACATCTTGGGCTCCAAC
Reverse Primer: A1164_R ATTACAGGTGTGAGCCACTGC
Reviews

Customers who bought this product also purchased
A1165
A1165
A1163
A1163
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10088
1 x A11644
1 x A11361
1 x A10658
1 x A10223
1 x A11119
1 x A11533
1 x A11477
1 x A11215
1 x A10650
$180.00
Haplogroup Info
Other products
Currencies