Top » Catalog » SNPs » A1168

$18.00

A1168
[A1168]

A1168
HG19 Position: ChrY:6536439..6536439
Ancestral: T
Derived: C
Reference: Petr Soucek
ISOGG Haplogroup: R1b1a1a2a1a2b1c2b1a
Comments: Downstream R1b-Z49 -> S8183 -> Y4536 -> Y4533 -> S12993/Y4354/Y4355
Forward Primer: A1168_F ATGTATATATTATAGGTATCATAAAATACCGACAC
Reverse Primer: A1168_R TTTTACGATACCGATAAATATAATATATGC
Reviews

Customers who bought this product also purchased
S12993
S12993
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10841
1 x A10662
1 x A10291
1 x A11660
1 x A11307
$90.00
Haplogroup Info
Other products
Currencies