Top » Catalog » SNPs » A1170

$18.00

A1170
[A1170]

A1170
hg38 Position: ChrY:8153878..8153878
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC5561
Forward Primer: A1170_F TGACTGTACAGATGTCAGTAATGGG
Reverse Primer: A1170_R GATTTCTTTCGTTCTCTACCTTGG
Reviews

Customers who bought this product also purchased
A1177
A1177
A1175
A1175
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies