Top » Catalog » SNPs » A1175

$18.00

A1175
[A1175]

A1175
hg38 Position: ChrY:17196586..17196586
Ancestral: T
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC5561
Forward Primer: A1175_F TTCTTCCAAATAAATGTTTAGGCTG
Reverse Primer: A1175_R GCAATTCAGGCAGATCAAGG
Reviews

Customers who bought this product also purchased
A1170
A1170
A1177
A1177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies