Top » Catalog » SNPs » S16994

$18.00

S16994
[S16994]

S16994
hg38 Position: ChrY:13211355..13211355
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c2a (not listed)
Comments: Comprises the third branch of R-U198
Forward Primer: S16994_F TCCAGATCCAAGAGCATTCC
Reverse Primer: S16994_R GCCTGCCTGAAAATCACAG
Reviews (2)

Customers who bought this product also purchased
L48
L48
S1686
S1686
Z18
Z18
DF96
DF96
Y14201
Y14201
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies