Top » Catalog » SNPs » PF2546

$18.00

PF2546
[PF2546]

PF2546
hg38 Position: ChrY:18902181..18902181
Ancestral: T
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E1b1b1b1a1
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF2546_F CACAATGCCATGAGCAAAAG
Reverse Primer: PF2546_R TTTGGCGTCTGTGTTCATTC
Reviews

Customers who bought this product also purchased
BY9698
BY9698
MZ19
MZ19
BY9954
BY9954
MZ149
MZ149
Y101404
Y101404
MZ39
MZ39
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies