Top » Catalog » SNPs » S1688

$18.00

S1688
[S1688]

S1688
hg38 Position: ChrY:20953587..20953587
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2a
Comments: Downstream of Z301 and upstream of U198.
Forward Primer: S1688_F CCTGCTTATTTCCCTGAGCTG
Reverse Primer: S1688_R GTGGCCAGGAGACCAATAAC
Reviews

Customers who bought this product also purchased
JFS0071
JFS0071
FGC12309
FGC12309
S1687
S1687
FT3093
FT3093
JFS0026
JFS0026
JFS0029
JFS0029
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies