Top » Catalog » SNPs » A1

$18.00

A1
[A1]

A1
HG19 Position: ChrY:14055503..14055503
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person
Forward Primer: A1_F ACTAGAACTCAGGACTAAGAAACTCACC
Reverse Primer: A1_R CTCCTTCAGTTCTGCTCTGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies