Top » Catalog » SNPs » A25

$19.00

A25
[A25]

A25
hg38 Position: ChrY:21808289..21808289
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Found in a R1b-Z253 person
Forward Primer: A25_F ATCATGATAGATAGGATAGACGGGTG
Reverse Primer: A25_R GACATGTTTTGGCGACCCT
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies