Top » Catalog » SNPs » A1367

$19.00

A1367
[A1367]

A1367
hg38 Position: ChrY:19505550..19505550
Ancestral: C
Derived: A
Reference: Paul Beatty (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1367_F CCTGCTATGCTGGGGTAGTG
Reverse Primer: A1367_R AGGGCAAAGTGACGTACCTG
Reviews

Customers who bought this product also purchased
A1154
A1154
Z16434
Z16434
A1247
A1247
Z16437
Z16437
A816
A816
S11556
S11556
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies