Top » Catalog » SNPs » A33

$19.00

A33
[A33]

A33
hg38 Position: ChrY:13423153..13423153
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A33_F TCAGGACCCATCTCAAAATTC
Reverse Primer: A33_R GCTTGTTCTGCTGACACTGC
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF41
DF41
FGC45280
FGC45280
L1335
L1335
BY150
BY150
Z39589
Z39589
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies