Top » Catalog » SNPs » A1499

$19.00

A1499
[A1499]

A1499
hg38 Position: ChrY:14969465..14969465
Ancestral: A
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1499_F TGTTTTATGTCCATCTACCATTTCTG
Reverse Primer: A1499_R TGTATTCTTCATTTTCACAAGATGC
Reviews

Customers who bought this product also purchased
A1504
A1504
A1497
A1497
A1489
A1489
A1494
A1494
A1501
A1501
A1509
A1509
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies