Top » Catalog » SNPs » FGC22951

$18.00

FGC22951
[FGC22951]

FGC22951
hg38 Position: ChrY:13810761..13810761
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC22951_F GGTGCTCCTATGCAGGC
Reverse Primer: FGC22951_R ACATACCAAATTGTAAAGACCATCTG
Reviews

Customers who bought this product also purchased
FGC22950
FGC22950
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies