Top » Catalog » SNPs » Y129297

$18.00

Y129297
[Y129297]

Y129297
hg38 Position: ChrY:20963653..20963653
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y129297_F CACATCACCTCAGTGCTTGG
Reverse Primer: Y129297_R TCTCTCTTGCTGCCCTCAAC
Reviews

Customers who bought this product also purchased
Y130251
Y130251
Y128458
Y128458
Y128778
Y128778
Y128977
Y128977
Y129192
Y129192
Y130248
Y130248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies