Top » Catalog » SNPs » BY79542

$18.00

BY79542
[BY79542]

BY79542
hg38 Position: ChrY:9620785..9620785
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below P312 > ZZ38 > Z29645
Forward Primer: BY79542_F TTTTGGTTCAGATGGCATTTATAAC
Reverse Primer: BY79542_R TTTTTCAAAGTTCATTGTATGCATACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies