Top » Catalog » SNPs » Z27030

$18.00

Z27030
[Z27030]

Z27030
hg38 Position: ChrY:13108770..13108770
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: I2
Comments: Below Z27034
Forward Primer: Z27030_F AGTTACATTACTCTGCCATTAAACATTAGAG
Reverse Primer: Z27030_R CTGAGCAATACAGCAAGATCC
Reviews

Customers who bought this product also purchased
Z105
Z105
BY130413
BY130413
Y24017
Y24017
PF4088
PF4088
Z27034
Z27034
A19455
A19455
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies