Top » Catalog » SNPs » Y5178

$18.00

Y5178
[Y5178]

Y5178
hg38 Position: ChrY:21160324..21160324
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: J2
Comments: Below L26 > L558 > Y5007
Forward Primer: Y5178_F TTCCTGGACTGTATGAGAAAAGC
Reverse Primer: Y5178_R TGGTCCACATAAATGCGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies