Top » Catalog » SNPs » Y5178

$18.00

Y5178
[Y5178]

Y5178
hg38 Position: ChrY:21160324..21160324
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: J2
Comments: Below L26 > L558 > Y5007
Forward Primer: Y5178_F TTCCTGGACTGTATGAGAAAAGC
Reverse Primer: Y5178_R TGGTCCACATAAATGCGTAGG
Reviews

Customers who bought this product also purchased
Z39482
Z39482
FGC19515
FGC19515
S18579
S18579
Y5501
Y5501
Z2227
Z2227
S18115
S18115
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies