Top » Catalog » SNPs » BY72848

$18.00

BY72848
[BY72848]

BY72848
hg38 Position: ChrY:8579240..8579240
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > FGC10125 > A11446
Forward Primer: BY72848_F GTGCTTCCTCTTTTTGACTTCAAAC
Reverse Primer: BY72848_R CAAGTGTGGACACCACATCC
Reviews (1)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY72848
$18.00
Haplogroup Info
Other products
Currencies