Top » Catalog » SNPs » FGC5539

$18.00

FGC5539
[FGC5539]

FGC5539
hg38 Position: ChrY:16730660..16730660
Ancestral: T
Derived: C
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person. downstream of FGC5521
Forward Primer: FGC5539_F TGGATTGCTCAATTGCTCTC
Reverse Primer: FGC5539_R TGAAGAGATTTTTGCCAGCAC
Reviews

Customers who bought this product also purchased
DF13
DF13
A1487
A1487
S2202
S2202
YFS444735
YFS444735
S1088
S1088
FGC5496
FGC5496
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies