Top » Catalog » SNPs » FGC3903

$18.00

FGC3903
[FGC3903]

FGC3903
hg38 Position: ChrY:8513793..8513793
Ancestral: C
Derived: G
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g2
Comments: Aka S5201. between DF21 and Z246
Forward Primer: FGC3903_F AACTGCAGCGGGTTGAATAC
Reverse Primer: FGC3903_R AGGGTCTCTTCAGGACAGAGG
Reviews

Customers who bought this product also purchased
Z16292
Z16292
Z16288
Z16288
Y16490
Y16490
S3058
S3058
Y16690
Y16690
Z16532
Z16532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies