Top » Catalog » SNPs » A117

$18.00

A117
[A117]

A117
HG19 Position: ChrY:7265039..7265039
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person
Forward Primer: A117_F CAGTGAGACCAAGAACCCACA
Reverse Primer: A117_R AACACAGCTTTTTGCCAGAAGT
Reviews

Customers who bought this product also purchased
S1088
S1088
Y9097
Y9097
PF5191
PF5191
A1298
A1298
YFS444735
YFS444735
Z16502
Z16502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies