Top » Catalog » SNPs » A117

$18.00

A117
[A117]

A117
HG19 Position: ChrY:7265039..7265039
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person
Forward Primer: A117_F CAGTGAGACCAAGAACCCACA
Reverse Primer: A117_R AACACAGCTTTTTGCCAGAAGT
Reviews

Customers who bought this product also purchased
YFS444735
YFS444735
Z16502
Z16502
FGC5511
FGC5511
FGC7448
FGC7448
FGC5521
FGC5521
R1b-FGC5494 Panel
R1b-FGC5494 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1105
1 x A10652
$36.00
Haplogroup Info
Other products
Currencies