Top » Catalog » SNPs » A117

$18.00

A117
[A117]

A117
HG19 Position: ChrY:7265039..7265039
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496 person
Forward Primer: A117_F CAGTGAGACCAAGAACCCACA
Reverse Primer: A117_R AACACAGCTTTTTGCCAGAAGT
Reviews

Customers who bought this product also purchased
A1298
A1298
YFS444735
YFS444735
Z16502
Z16502
FGC5511
FGC5511
FGC7448
FGC7448
FGC5521
FGC5521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11631
1 x A10552
1 x A10538
1 x A11478
1 x A1066
1 x A100
$108.00
Haplogroup Info
Other products
Currencies