Top » Catalog » SNPs » FGC8712

$18.00

FGC8712
[FGC8712]

FGC8712
hg38 Position: ChrY:15272075..15272075
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y6074. approx. Y4349
Forward Primer: FGC8712_F CCAACATGGTGAAACTGCC
Reverse Primer: FGC8712_R AGCATGACATTCTGTGACTGC
Reviews

Customers who bought this product also purchased
ZS5871
ZS5871
FGC9587
FGC9587
L858
L858
FGC1713
FGC1713
ZS5868
ZS5868
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies