Top » Catalog » SNPs » Z1297

$18.00

Z1297
[Z1297]

Z1297
hg38 Position: ChrY:19329026..19329026
Ancestral: T
Derived: A
Reference: http://dna-forums.org (B. Schrack 2011)
ISOGG Haplogroup: J2b2a1a1a1a
Comments: Downstream of L283. upstream of Z631-Z639
Forward Primer: Z1297_F TCTCCACCACATGGAGAATC
Reverse Primer: Z1297_R TCCCTCCCCGTGTTTATATG
Reviews

Customers who bought this product also purchased
FT124757
FT124757
CTS9687
CTS9687
Y166564
Y166564
FT124983
FT124983
Y61095
Y61095
Y21045
Y21045
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies