Top » Catalog » SNPs » L24

$18.00

L24
[L24]

L24
hg38 Position: ChrY:12165822..12165822
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h
Comments: .
Forward Primer: L24_F GAGAGAGAGACATTATATTTAGGGAAACAG
Reverse Primer: L24_R CTGAGGTCAAATCATACATGTTCCT
Reviews

Customers who bought this product also purchased
Z6049
Z6049
Y28886
Y28886
M96
M96
Y29011
Y29011
FGC56202
FGC56202
Y84796
Y84796
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies