Top » Catalog » SNPs » A1036

$17.50

A1036
[A1036]

A1036
HG19 Position: ChrY:6865196..6865196
Ancestral: C
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream Z253 > A1002
Forward Primer: A1036_F TCCTGGGTACGATGTCACAC
Reverse Primer: A1036_R ACTCGTTGCAAGGTTCAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies