Top » Catalog » SNPs » A2148

$19.00

A2148
[A2148]

A2148
hg38 Position: ChrY:7879561..7879561
Ancestral: G
Derived: A
Reference: Charles Moore (2015)
ISOGG Haplogroup: R1b1a1a2a1a1f
Comments: At the top of U106
Forward Primer: A2148_F GGCCCTAGCCAAAGAGTACTG
Reverse Primer: A2148_R ACTGACAGTAAGGACTGTCACCAC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies