Top » Catalog » SNPs » A2155

$18.00

A2155
[A2155]

A2155
hg38 Position: ChrY:15090238..15090238
Ancestral: T
Derived: C
Reference: Charles Acree (2015)
ISOGG Haplogroup: R1b1a2a1a1c (not listed)
Comments: .
Forward Primer: A2155_F ATCTGCTGACCTCGTGATCC
Reverse Primer: A2155_R AGGAGCAAATTGTGGCATTC
Reviews

Customers who bought this product also purchased
DYS385
DYS385
A2154
A2154
A2156
A2156
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies