Top » Catalog » SNPs » A2157

$18.00

A2157
[A2157]

A2157
hg38 Position: ChrY:20022748..20022748
Ancestral: T
Derived: C
Reference: Charles Acree (2015)
ISOGG Haplogroup: R1b1a2a1a1c (not listed)
Comments: .
Forward Primer: A2157_F CGTGCTTGGCCTAAGTATAATG
Reverse Primer: A2157_R AGGAGCTGTTTCTGGATAACG
Reviews

Customers who bought this product also purchased
A12600
A12600
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19149
1 x A4596
$36.00
Haplogroup Info
Other products
Currencies