Top » Catalog » SNPs » L1019

$18.00

L1019
[L1019]

L1019
hg38 Position: ChrY:14526872..14526872
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a6~
Comments: Found in a hg E-V13 WTY participant
Forward Primer: L1019_F CTTCATATACAGTAGGCCCTAAAACC
Reverse Primer: L1019_R AAAAGGTCATTCGGTCATGC
Reviews

Customers who bought this product also purchased
FGC14564
FGC14564
Z16242
Z16242
FGC14571
FGC14571
FGC14558
FGC14558
FGC19309
FGC19309
FGC14563
FGC14563
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies