Top » Catalog » SNPs » Y134078

$18.00

Y134078
[Y134078]

Y134078
hg38 Position: ChrY:26636849..26636849
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y134078_F TCCATTTTACTCATGAGGAAAGTGAC
Reverse Primer: Y134078_R CTTAAACTGGAGATATGGGGTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
$18.00
Haplogroup Info
Other products
Currencies