Top » Catalog » SNPs » ZQ104

$18.00

ZQ104
[ZQ104]

ZQ104
hg38 Position: ChrY:7933872..7933872
Ancestral: C
Derived: T
Reference: Gabit Baimbetov (2017)
ISOGG Haplogroup: C2b1a2a
Comments: .
Forward Primer: ZQ104_F CAAATAGTTTGTCAGCAAGCCTACTATAC
Reverse Primer: ZQ104_R ATCTTGGGGTCTATAAGCAAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies