Top » Catalog » SNPs » FGCLR697

$18.00

FGCLR697
[FGCLR697]

FGCLR697
hg38 Position: ChrY:16570770..16570770
Ancestral: C
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R2
Comments: Below L1069
Forward Primer: FGCLR697_F GTGTGTGGATCACCTGAGGTC
Reverse Primer: FGCLR697_R ACATACCCCAGGGTGGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
1 x mtComplete
1 x mtUpgrade
$298.00
Haplogroup Info
Other products
Currencies