Top » Catalog » SNPs » Y125026

$18.00

Y125026
[Y125026]

Y125026
hg38 Position: ChrY:14068330..14068330
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y125026_F TTCCCCCAAACAACACCTAC
Reverse Primer: Y125026_R GCCAGTACCACGCTGTTTTG
Reviews

Customers who bought this product also purchased
S2606
S2606
BY184790
BY184790
I1 Superclade Panel
I1 Superclade Panel
PH1237
PH1237
BY111953
BY111953
I2 Superclade Panel
I2 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies