Top » Catalog » SNPs » FGC74108

$18.00

FGC74108
[FGC74108]

FGC74108
hg38 Position: ChrY:2871340..2871340
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC74108_F CCTGGTGCTATTTACTTCTGGTG
Reverse Primer: FGC74108_R TGAGTACCACAGGTAAGTGCTATGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies