Top » Catalog » SNPs » Y129964

$19.00

Y129964
[Y129964]

Y129964
hg38 Position: ChrY:15094424..15094424
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y129964_F ATAGTCTATTTTCCCTACTTTCTGAATGTGAG
Reverse Primer: Y129964_R ATCCTAGGAGGTGGATGTTGTAG
Reviews

Customers who bought this product also purchased
Y128502
Y128502
F15443
F15443
FGC17371
FGC17371
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies