Top » Catalog » SNPs » ZS2053

$18.00

ZS2053
[ZS2053]

ZS2053
hg38 Position: ChrY:9804104..9804104
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 205557; downstream BY6
Forward Primer: ZS2053_F GGAAAACTCCCGATTTGACC
Reverse Primer: ZS2053_R CTTTCCCGAAGTCCCTTTTC
Reviews

Customers who bought this product also purchased
ZS2069
ZS2069
FGC43091
FGC43091
ZS11025
ZS11025
ZS4082
ZS4082
BY4
BY4
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies