Top » Catalog » SNPs » L829

$18.00

L829
[L829]

L829
hg38 Position: ChrY:15398389..15398389
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1 not listed
Comments: Found in a hg J-L147.1 WTY participant
Forward Primer: L829_F CTGAATTTTAGCCCCCAGTG
Reverse Primer: L829_R TGTAGGAACACACCACTTCTGC
Reviews (1)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies