$25.00

mt04 (1158 - 1764)
[mt4]

mt04 (1158 - 1764)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 1158
End Coverage: np 1764

Primers:
mt4_F: CAGAACACTACGAGCCACAGC
mt4_R: GGTACTATATCTATTGCGCCAGG

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies