$25.00

mt06 (2417 - 3054)
[mt6]

mt06 (2417 - 3054)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 16493
End Coverage: np 370

Primers:
mt6_F: TCAACCAACAAGTCATTATTACCC
mt6_R: GTCTGAACTCAGATCACGTAGGAC

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies