$25.00

mt10 (4858 - 5551)
[mt10]

mt10 (4858 - 5551)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 4858
End Coverage: np 5551

Primers:
mt10_F: TGACATCCGGCCTGCTC
mt10_R: AGAAATTAAGTATTGCAACTTACTGAGG

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies