$25.00

mt11 (5547 - 6023)
[mt11]

mt11 (5547 - 6023)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 5547
End Coverage: np 6023

Primers:
mt11_F: GGTTAAATACAGACCAAGAGCCTTC
mt11_R: CCTGGCTGGCCCAGC

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies