$25.00

mt15 (7523 - 7891)
[mt15]

mt15 (7523 - 7891)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 7523
End Coverage: np 7891

Primers:
mt15_F: CCTCCATGACTTTTTCAAAAAGG
mt15_R: TACTCGTAGGTTCAGTACCATTGG

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies