$25.00

mt16 (7870 - 8545)
[mt16]

mt16 (7870 - 8545)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 7870
End Coverage: np 8545

Primers:
mt16_F: TAACAGTCAACGATCCCTCCC
mt16_R: GGGGGCAATGAATGAAGC

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies