$25.00

mt20 (10416 - 11013)
[mt20]

mt20 (10416 - 11013)
Sequence of a single amplicon on the human mitochondrial DNA.

Start Coverage: np 10416
End Coverage: np 11013

Primers:
mt20_F: GATTAGACTGAACCGAATTGGTATATAG
mt20_R: TTTCGTGATAGTGGTTCACTGG

Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies